Review



algorithms incucyte s3 software sartorius prism 10 graphpad software flowjo bd compass  (Sartorius AG)


Bioz Verified Symbol Sartorius AG is a verified supplier
Bioz Manufacturer Symbol Sartorius AG manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    Sartorius AG algorithms incucyte s3 software sartorius prism 10 graphpad software flowjo bd compass
    Algorithms Incucyte S3 Software Sartorius Prism 10 Graphpad Software Flowjo Bd Compass, supplied by Sartorius AG, used in various techniques. Bioz Stars score: 99/100, based on 16124 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/flowjo+analysis+software/Live+Cell+Analysis+Instruments/pmc12490239__mmc8-200-17-21
    Average 99 stars, based on 16124 article reviews
    algorithms incucyte s3 software sartorius prism 10 graphpad software flowjo bd compass - by Bioz Stars, 2026-11
    99/100 stars

    Images

    Related Articles

    Software:

    Article Title: Design of a fragment crystallizable-engineered tetravalent bispecific antibody targeting programmed cell death-1 and vascular endothelial growth factor with cooperative biological effects.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER LDH assay kit Roche 11644793001 ELISA Dakewe 1110202,1110002 DynabeadsTM M280 anti-mouse IgG Fc beads Thermofisher 11202D Experimental models: Organisms/strains SCID/Beige mice Beiing Vital River Laboratory AnimalTechnology Co., Ltd. N/A C57BL/6-hPD-1/hPD-L1/hCD73 transgenic mice GemPharmatech Co., Ltd N/A Cynomolgus monkeys (M. fascicularis) Guangxi Guidong Quadrumana Development&Laboratory Co. Ltd. (Guigang, Guangxi, CHN) Guangxi Grandforest Scientific Primate Company (Guigang, Guangxi, CHN), Ltd. Beijing Primas Biotech Co. Ltd. (Beijing, CHN) N/A Experimental models: Cell lines 293T cells Wuhan University N/A 293T-PD1 cells Akeso Biopharma N/A Jurkat cells Chinese Academy of Sciences SCSP-513 Jurkat-PD-1 cells Akeso Biopharma N/A HUVECs Allcells H-001F-C PD-L1 aAPC/CHO-K1 cells Promega J112A PD-1 effector cells Promega J108A 293T-KDR-NFAT-LUC cells Akeso Biopharma N/A Raji cells Chinese Academy of Sciences, Shanghai Branch TCHu 44 Raji-PD-L1 cells Akeso Biopharma N/A Jurkat-NFAT-CD64-CD32H cells Akeso Biopharma N/A HCC827 JENNIO Biological N/A .. MC38-hPD-L1/hCD73 cells GemPharmatech N/A CHO-K1-PD-1 cells Akeso Biopharma N/A Software and algorithms Fortebio Octet molecular interaction system Pall/Fortebio Model: Octet QKe Fortebio Data Acquisition 7.0 N/A Fortebio Data Analysis 7.0 N/A Ficoll-PaqueTM Plus GE 17-1440-02 Prism 8.0 GraphPad https://www.graphpad.com/feature FlowJo_V10 BD Biosciences https://www.flowjo.com/ .. HUVECs (human umbilical vein endothelial cell) were cultured in HUVEC cell culture medium (Allcells, H-004).

    Article Title: Prolonging lung cancer response to EGFR inhibition by targeting the selective advantage of resistant cells
    Article Snippet: .. Luca Grumolato Jun 2, 2025 ChemiDoc Imaging System (Bio-Rad), QuantStudio Flex PCR System (Thermo Scientific), Beckman Coulter CytoFLEX, Infinite F200 PRO (TECAN), Illumina MiniSeq, Incucyte® S3 Live-Cell Analysis System (Sartorius), Axioscope 7 microscope, Exigo H400 system Prism 4 software from GraphPad (GraphPad Software Inc), Microsoft Excel LTSC MSO (16.0.14332.21031) 64 bits, Image Lab Software (version 6.0.1; Bio-Rad), QuantStudio Design and Analysis Software (v1.4.3; Thermo Scientific), CytExpert software (v2.5.0.77; Beckman Coulter), Imaris software (v10.0.2; Bitplane), Incucyte software (v2021C; Sartorius), FlowJo software (V10.10.0, Becton Dickinson). re p o rtfo lio | rep o rtin g su m m ary A pril2023 Data Policy information about availability of data All manuscripts must include a data availability statement. ..

    Article Title: Non-canonical activating roles of RCoR2 sustain transcription in adrenergic neuroblastoma.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER TrimGalore (v. 0.6.7) Babraham Bioinformatics 73 https://www.bioinformatics.babraham.ac. uk/projects/trim_galore/ HISAT2 (v. 2.2.1) Kim et al. 74 N/A StringTie (v2.1.7) Pertea et al. 75 N/A R package DESeq2 Love et al. 76 N/A Nextflow nf-core/atacseq pipeline (v. 2.1.2) nf-core 77 https://github.com/nf-core/atacseq HiC-Pro (v. 2.11.1) Servant et al. 78 N/A Juicebox Durand et al. 79 N/A GraphPad Prism-GraphPad Software (v. 9.5.1) GraphPad Software Inc RRID: SCR_002798 ImageJ ImageJ N/A GSEA (Broad Institute, v.4.3.2) Subramanian et al., Mootha et al. 80,81 N/A Incucyte® Software Sartorius N/A FlowJo TM BD Life Sciences N/A R2 genomics R2 genomics https://r2.amc.nl/ R (v.4.3.0) R Development Core Team https://www.R-project.org/ 20 Cell Reports ▪▪, 115951, ▪▪, 2025 OPEN ACCESS Whole cell lysates, nuclear extract and western blots To confirm RCOR1 and RCOR2 knockdown, whole-cell lysates were prepared in RIPA buffer (50 mM Tris-HCl pH 7.8, 150 mM NaCl, 1% NP-40, 0.5% DOC, 0.1% SDS, 2 mM Phenylmethylsulfonyl fluoride (PMSF), 1X Roche Complete Protease Inhibitor cocktail), while, because of an intense cytosolic unspecific band, RCoR3 levels were detected on nuclear extract. .. In particular, cells were washed in ice-cold PBS, resuspended in Ipotonic Buffer (10 mM HEPES, 50 mM NaCl, 0.5 mM DTT, 1 mM NaPiro, 1 mM NaOrtho, 1 mM NaFluor, 1 mM PMSF, 1X Roche Complete Protease Inhibitor cocktail) and pelleted by centrifugation at 300g for 5 min.

    Article Title: Chikungunya virus uses the tetraspanins CD63, CD9, and CD151 to replicate in human synovial fibroblasts.
    Article Snippet: .. Oligonucleotides Silencer negative control no. 2 siRNA Thermo Fisher Scientific Cat# AM4613 Silencer GFP siRNA Thermo Fisher Scientific Cat# AM4626 CATCTGCACCCAAGTGTACCA microsynth qPCR CHIKV fw GCGCATTTTGCCTTCGTAATG microsynth qPCR CHIKV rev 6FAM-CggTgTACACTgCCTgTgACYgC—BBQ TIB MolBiol CHIKV probe Recombinant DNA pczVSV-G Hoffmann et al.43 https://doi.org/10.1099/vir.0.023978–0 pIRES2-eGFP CHIKV E3-E1 Salvador et al.44 https://doi.org/10.1016/j.virol.2009.07.013 pChik-LR-5‘GFP Tsetsarkin et al.40 https://doi.org/10.1089/vbz.2006.6.325 pChikRepl-eGFP Gläsker et al.45 https://doi.org/10.1186/1743-422X-10–23 pcDNA3.1(+) Addgene Cat# V790-20 Software and algorithms Fiji – ImageJ https://github.com/fiji/fiji Version 2.14.0/1.54f Graph Pad Prism Dotmatics Version 10 Incucyte Sartorius Version 2020 FlowJo FlowJo LLC Version 10.10.1 Huygens Compute Engine Scientific Volume Imaging Version 26.04 Adobe Illustrator Adobe Version 29.8.7 Affinity Studio Affinity Version 3.2.1 BioRender BioRender (https://biorender.com) RRID:SCR_018361 Other Chamber slides 8 well Ibidi Cat# 80841 Cell Reports 45, 118058, October 27, 2026 13 .. For each target, 3 siRNAs were purchased from Thermo Fisher Scientific and pooled for reverse transfection (Table S1).

    Imaging:

    Article Title: Prolonging lung cancer response to EGFR inhibition by targeting the selective advantage of resistant cells
    Article Snippet: .. Luca Grumolato Jun 2, 2025 ChemiDoc Imaging System (Bio-Rad), QuantStudio Flex PCR System (Thermo Scientific), Beckman Coulter CytoFLEX, Infinite F200 PRO (TECAN), Illumina MiniSeq, Incucyte® S3 Live-Cell Analysis System (Sartorius), Axioscope 7 microscope, Exigo H400 system Prism 4 software from GraphPad (GraphPad Software Inc), Microsoft Excel LTSC MSO (16.0.14332.21031) 64 bits, Image Lab Software (version 6.0.1; Bio-Rad), QuantStudio Design and Analysis Software (v1.4.3; Thermo Scientific), CytExpert software (v2.5.0.77; Beckman Coulter), Imaris software (v10.0.2; Bitplane), Incucyte software (v2021C; Sartorius), FlowJo software (V10.10.0, Becton Dickinson). re p o rtfo lio | rep o rtin g su m m ary A pril2023 Data Policy information about availability of data All manuscripts must include a data availability statement. ..

    Article Title: Chikungunya virus uses the tetraspanins CD63, CD9, and CD151 to replicate in human synovial fibroblasts.
    Article Snippet: .. Oligonucleotides Silencer negative control no. 2 siRNA Thermo Fisher Scientific Cat# AM4613 Silencer GFP siRNA Thermo Fisher Scientific Cat# AM4626 CATCTGCACCCAAGTGTACCA microsynth qPCR CHIKV fw GCGCATTTTGCCTTCGTAATG microsynth qPCR CHIKV rev 6FAM-CggTgTACACTgCCTgTgACYgC—BBQ TIB MolBiol CHIKV probe Recombinant DNA pczVSV-G Hoffmann et al.43 https://doi.org/10.1099/vir.0.023978–0 pIRES2-eGFP CHIKV E3-E1 Salvador et al.44 https://doi.org/10.1016/j.virol.2009.07.013 pChik-LR-5‘GFP Tsetsarkin et al.40 https://doi.org/10.1089/vbz.2006.6.325 pChikRepl-eGFP Gläsker et al.45 https://doi.org/10.1186/1743-422X-10–23 pcDNA3.1(+) Addgene Cat# V790-20 Software and algorithms Fiji – ImageJ https://github.com/fiji/fiji Version 2.14.0/1.54f Graph Pad Prism Dotmatics Version 10 Incucyte Sartorius Version 2020 FlowJo FlowJo LLC Version 10.10.1 Huygens Compute Engine Scientific Volume Imaging Version 26.04 Adobe Illustrator Adobe Version 29.8.7 Affinity Studio Affinity Version 3.2.1 BioRender BioRender (https://biorender.com) RRID:SCR_018361 Other Chamber slides 8 well Ibidi Cat# 80841 Cell Reports 45, 118058, October 27, 2026 13 .. For each target, 3 siRNAs were purchased from Thermo Fisher Scientific and pooled for reverse transfection (Table S1).

    Polymerase Chain Reaction:

    Article Title: Prolonging lung cancer response to EGFR inhibition by targeting the selective advantage of resistant cells
    Article Snippet: .. Luca Grumolato Jun 2, 2025 ChemiDoc Imaging System (Bio-Rad), QuantStudio Flex PCR System (Thermo Scientific), Beckman Coulter CytoFLEX, Infinite F200 PRO (TECAN), Illumina MiniSeq, Incucyte® S3 Live-Cell Analysis System (Sartorius), Axioscope 7 microscope, Exigo H400 system Prism 4 software from GraphPad (GraphPad Software Inc), Microsoft Excel LTSC MSO (16.0.14332.21031) 64 bits, Image Lab Software (version 6.0.1; Bio-Rad), QuantStudio Design and Analysis Software (v1.4.3; Thermo Scientific), CytExpert software (v2.5.0.77; Beckman Coulter), Imaris software (v10.0.2; Bitplane), Incucyte software (v2021C; Sartorius), FlowJo software (V10.10.0, Becton Dickinson). re p o rtfo lio | rep o rtin g su m m ary A pril2023 Data Policy information about availability of data All manuscripts must include a data availability statement. ..

    Microscopy:

    Article Title: Prolonging lung cancer response to EGFR inhibition by targeting the selective advantage of resistant cells
    Article Snippet: .. Luca Grumolato Jun 2, 2025 ChemiDoc Imaging System (Bio-Rad), QuantStudio Flex PCR System (Thermo Scientific), Beckman Coulter CytoFLEX, Infinite F200 PRO (TECAN), Illumina MiniSeq, Incucyte® S3 Live-Cell Analysis System (Sartorius), Axioscope 7 microscope, Exigo H400 system Prism 4 software from GraphPad (GraphPad Software Inc), Microsoft Excel LTSC MSO (16.0.14332.21031) 64 bits, Image Lab Software (version 6.0.1; Bio-Rad), QuantStudio Design and Analysis Software (v1.4.3; Thermo Scientific), CytExpert software (v2.5.0.77; Beckman Coulter), Imaris software (v10.0.2; Bitplane), Incucyte software (v2021C; Sartorius), FlowJo software (V10.10.0, Becton Dickinson). re p o rtfo lio | rep o rtin g su m m ary A pril2023 Data Policy information about availability of data All manuscripts must include a data availability statement. ..

    Western Blot:

    Article Title: Non-canonical activating roles of RCoR2 sustain transcription in adrenergic neuroblastoma.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER TrimGalore (v. 0.6.7) Babraham Bioinformatics 73 https://www.bioinformatics.babraham.ac. uk/projects/trim_galore/ HISAT2 (v. 2.2.1) Kim et al. 74 N/A StringTie (v2.1.7) Pertea et al. 75 N/A R package DESeq2 Love et al. 76 N/A Nextflow nf-core/atacseq pipeline (v. 2.1.2) nf-core 77 https://github.com/nf-core/atacseq HiC-Pro (v. 2.11.1) Servant et al. 78 N/A Juicebox Durand et al. 79 N/A GraphPad Prism-GraphPad Software (v. 9.5.1) GraphPad Software Inc RRID: SCR_002798 ImageJ ImageJ N/A GSEA (Broad Institute, v.4.3.2) Subramanian et al., Mootha et al. 80,81 N/A Incucyte® Software Sartorius N/A FlowJo TM BD Life Sciences N/A R2 genomics R2 genomics https://r2.amc.nl/ R (v.4.3.0) R Development Core Team https://www.R-project.org/ 20 Cell Reports ▪▪, 115951, ▪▪, 2025 OPEN ACCESS Whole cell lysates, nuclear extract and western blots To confirm RCOR1 and RCOR2 knockdown, whole-cell lysates were prepared in RIPA buffer (50 mM Tris-HCl pH 7.8, 150 mM NaCl, 1% NP-40, 0.5% DOC, 0.1% SDS, 2 mM Phenylmethylsulfonyl fluoride (PMSF), 1X Roche Complete Protease Inhibitor cocktail), while, because of an intense cytosolic unspecific band, RCoR3 levels were detected on nuclear extract. .. In particular, cells were washed in ice-cold PBS, resuspended in Ipotonic Buffer (10 mM HEPES, 50 mM NaCl, 0.5 mM DTT, 1 mM NaPiro, 1 mM NaOrtho, 1 mM NaFluor, 1 mM PMSF, 1X Roche Complete Protease Inhibitor cocktail) and pelleted by centrifugation at 300g for 5 min.

    Knockdown:

    Article Title: Non-canonical activating roles of RCoR2 sustain transcription in adrenergic neuroblastoma.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER TrimGalore (v. 0.6.7) Babraham Bioinformatics 73 https://www.bioinformatics.babraham.ac. uk/projects/trim_galore/ HISAT2 (v. 2.2.1) Kim et al. 74 N/A StringTie (v2.1.7) Pertea et al. 75 N/A R package DESeq2 Love et al. 76 N/A Nextflow nf-core/atacseq pipeline (v. 2.1.2) nf-core 77 https://github.com/nf-core/atacseq HiC-Pro (v. 2.11.1) Servant et al. 78 N/A Juicebox Durand et al. 79 N/A GraphPad Prism-GraphPad Software (v. 9.5.1) GraphPad Software Inc RRID: SCR_002798 ImageJ ImageJ N/A GSEA (Broad Institute, v.4.3.2) Subramanian et al., Mootha et al. 80,81 N/A Incucyte® Software Sartorius N/A FlowJo TM BD Life Sciences N/A R2 genomics R2 genomics https://r2.amc.nl/ R (v.4.3.0) R Development Core Team https://www.R-project.org/ 20 Cell Reports ▪▪, 115951, ▪▪, 2025 OPEN ACCESS Whole cell lysates, nuclear extract and western blots To confirm RCOR1 and RCOR2 knockdown, whole-cell lysates were prepared in RIPA buffer (50 mM Tris-HCl pH 7.8, 150 mM NaCl, 1% NP-40, 0.5% DOC, 0.1% SDS, 2 mM Phenylmethylsulfonyl fluoride (PMSF), 1X Roche Complete Protease Inhibitor cocktail), while, because of an intense cytosolic unspecific band, RCoR3 levels were detected on nuclear extract. .. In particular, cells were washed in ice-cold PBS, resuspended in Ipotonic Buffer (10 mM HEPES, 50 mM NaCl, 0.5 mM DTT, 1 mM NaPiro, 1 mM NaOrtho, 1 mM NaFluor, 1 mM PMSF, 1X Roche Complete Protease Inhibitor cocktail) and pelleted by centrifugation at 300g for 5 min.

    Protease Inhibitor:

    Article Title: Non-canonical activating roles of RCoR2 sustain transcription in adrenergic neuroblastoma.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER TrimGalore (v. 0.6.7) Babraham Bioinformatics 73 https://www.bioinformatics.babraham.ac. uk/projects/trim_galore/ HISAT2 (v. 2.2.1) Kim et al. 74 N/A StringTie (v2.1.7) Pertea et al. 75 N/A R package DESeq2 Love et al. 76 N/A Nextflow nf-core/atacseq pipeline (v. 2.1.2) nf-core 77 https://github.com/nf-core/atacseq HiC-Pro (v. 2.11.1) Servant et al. 78 N/A Juicebox Durand et al. 79 N/A GraphPad Prism-GraphPad Software (v. 9.5.1) GraphPad Software Inc RRID: SCR_002798 ImageJ ImageJ N/A GSEA (Broad Institute, v.4.3.2) Subramanian et al., Mootha et al. 80,81 N/A Incucyte® Software Sartorius N/A FlowJo TM BD Life Sciences N/A R2 genomics R2 genomics https://r2.amc.nl/ R (v.4.3.0) R Development Core Team https://www.R-project.org/ 20 Cell Reports ▪▪, 115951, ▪▪, 2025 OPEN ACCESS Whole cell lysates, nuclear extract and western blots To confirm RCOR1 and RCOR2 knockdown, whole-cell lysates were prepared in RIPA buffer (50 mM Tris-HCl pH 7.8, 150 mM NaCl, 1% NP-40, 0.5% DOC, 0.1% SDS, 2 mM Phenylmethylsulfonyl fluoride (PMSF), 1X Roche Complete Protease Inhibitor cocktail), while, because of an intense cytosolic unspecific band, RCoR3 levels were detected on nuclear extract. .. In particular, cells were washed in ice-cold PBS, resuspended in Ipotonic Buffer (10 mM HEPES, 50 mM NaCl, 0.5 mM DTT, 1 mM NaPiro, 1 mM NaOrtho, 1 mM NaFluor, 1 mM PMSF, 1X Roche Complete Protease Inhibitor cocktail) and pelleted by centrifugation at 300g for 5 min.

    other:

    Article Title: Combining BET inhibition with SMAC mimetics restricts tumor growth and triggers immune surveillance in preclinical cancer models
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER CD80 (B7-1) BD CAT# 940141; RRID:AB_2876030 CD274 (B7-H1) BD CAT# 940142; RRID:AB_2876031 CD40 BD CAT# 940143; RRID:AB_2876032 CD24 BD CAT# 940144; RRID:AB_2876033 CD223 (LAG-3) BD CAT# 940152; RRID:AB_2876041 H-2Kb BD CAT# 940164; RRID:AB_2876052 CD197 (CCR7) BD CAT# 940165; RRID:AB_2876053 CD326 (Ep-CAM) BD CAT# 940169; RRID:AB_2876056 CD1d BD CAT# 940171; RRID:AB_2876058 CD54 (ICAM-1) BD CAT# 940172; RRID:AB_2876059 CD14 BD CAT# 940174; RRID:AB_2876061 CD278(ICOS) BD CAT# 940176; RRID:AB_2876063 CD273 (PD-L2) BD CAT# 940180; RRID:AB_2876066 H-2Kd BD CAT# 940194; RRID:AB_2876077 CD115 BD CAT# 940198; RRID:AB_2876081 CD137 (4-1BB) BD CAT# 940199; RRID:AB_2876082 CD172a (SIRPα) BD CAT# 940201; RRID:AB_2876084 CD45RB BD CAT# 940206; RRID:AB_2876088 CXCR2 BD CAT# 940209; RRID:AB_2876091 TCR Vγ1.1 BD CAT# 940334; RRID:AB_2876207 CD45Ra BD CAT# 940335; RRID:AB_2876208 CD8a BD CAT# 940345; RRID:AB_2876217 CD25 BD CAT# 940356; RRID:AB_2876227 CD83 BD CAT# 940350; RRID:AB_2876221 CD272 BD CAT# 940415; RRID:AB_2876275 Vγ 3 TCR BD CAT# 940354; RRID:AB_2876225 F4/80-L BD CAT# 940412; RRID:AB_2876273 CD44 BD CAT# 940114; RRID:AB_2876004 CD11b BD CAT# 940008; RRID:AB_2875899 cIAP1 Cell Signaling CAT# 7065; RRID:AB_10890862 cIAP2 Cell Signaling CAT# 3130; RRID:AB_10693298 XIAP Cell Signaling CAT# 14334; RRID:AB_2784533 GAPDH Abcam CAT# 8245; RRID:AB_2107448 PARP Cell Signaling CAT# 9542; RRID:AB_2160739 Caspase-3 Cell Signaling CAT# 14220; RRID:AB_2798429 Cleaved Caspase-3 Cell Signaling CAT# 9664; RRID:AB_2070042 Goat anti-Mouse IgG (H + L) Secondary Antibody DyLight 650 Novus NBP1-75147C; RRID:AB_3219020 Chemicals, peptides, and recombinant proteins Z-VAD-FMK Sigma-Aldrich V116-2MG Etanercept (Enbrel ) Pfizer Necrostatin-1 MedChemExpress HY-15760 BI 894999 Boehringer Ingelheim BI 891065 Boehringer Ingelheim HaltTM protease and phosphatase inhibitor cocktail Thermo Fisher Scientific 78440 MSD Tris Lysis Buffer MSD R60TX-2 Calcein AM Thermo Fisher C1430 Draq7 BD 564904 AMPure XP Beckman Coulter A63880 (Continued on next page) e2 Cell Reports Medicine 6, 102313, September 16, 2025 Article ll OPEN ACCESS

    Article Title: Combining BET inhibition with SMAC mimetics restricts tumor growth and triggers immune surveillance in preclinical cancer models.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER CD80 (B7-1) BD CAT# 940141; RRID:AB_2876030 CD274 (B7-H1) BD CAT# 940142; RRID:AB_2876031 CD40 BD CAT# 940143; RRID:AB_2876032 CD24 BD CAT# 940144; RRID:AB_2876033 CD223 (LAG-3) BD CAT# 940152; RRID:AB_2876041 H-2Kb BD CAT# 940164; RRID:AB_2876052 CD197 (CCR7) BD CAT# 940165; RRID:AB_2876053 CD326 (Ep-CAM) BD CAT# 940169; RRID:AB_2876056 CD1d BD CAT# 940171; RRID:AB_2876058 CD54 (ICAM-1) BD CAT# 940172; RRID:AB_2876059 CD14 BD CAT# 940174; RRID:AB_2876061 CD278(ICOS) BD CAT# 940176; RRID:AB_2876063 CD273 (PD-L2) BD CAT# 940180; RRID:AB_2876066 H-2Kd BD CAT# 940194; RRID:AB_2876077 CD115 BD CAT# 940198; RRID:AB_2876081 CD137 (4-1BB) BD CAT# 940199; RRID:AB_2876082 CD172a (SIRPα) BD CAT# 940201; RRID:AB_2876084 CD45RB BD CAT# 940206; RRID:AB_2876088 CXCR2 BD CAT# 940209; RRID:AB_2876091 TCR Vγ1.1 BD CAT# 940334; RRID:AB_2876207 CD45Ra BD CAT# 940335; RRID:AB_2876208 CD8a BD CAT# 940345; RRID:AB_2876217 CD25 BD CAT# 940356; RRID:AB_2876227 CD83 BD CAT# 940350; RRID:AB_2876221 CD272 BD CAT# 940415; RRID:AB_2876275 Vγ 3 TCR BD CAT# 940354; RRID:AB_2876225 F4/80-L BD CAT# 940412; RRID:AB_2876273 CD44 BD CAT# 940114; RRID:AB_2876004 CD11b BD CAT# 940008; RRID:AB_2875899 cIAP1 Cell Signaling CAT# 7065; RRID:AB_10890862 cIAP2 Cell Signaling CAT# 3130; RRID:AB_10693298 XIAP Cell Signaling CAT# 14334; RRID:AB_2784533 GAPDH Abcam CAT# 8245; RRID:AB_2107448 PARP Cell Signaling CAT# 9542; RRID:AB_2160739 Caspase-3 Cell Signaling CAT# 14220; RRID:AB_2798429 Cleaved Caspase-3 Cell Signaling CAT# 9664; RRID:AB_2070042 Goat anti-Mouse IgG (H + L) Secondary Antibody DyLight 650 Novus NBP1-75147C; RRID:AB_3219020 Chemicals, peptides, and recombinant proteins Z-VAD-FMK Sigma-Aldrich V116-2MG Etanercept (Enbrel ) Pfizer Necrostatin-1 MedChemExpress HY-15760 BI 894999 Boehringer Ingelheim BI 891065 Boehringer Ingelheim Halt TM protease and phosphatase inhibitor cocktail Thermo Fisher Scientific 78440 MSD Tris Lysis Buffer MSD R60TX-2 Calcein AM Thermo Fisher C1430 Draq7 BD 564904 AMPure XP Beckman Coulter A63880 (Continued on next page) e2 Cell Reports Medicine 6, 102313, September 16, 2025 OPEN ACCESS

    Negative Control:

    Article Title: Chikungunya virus uses the tetraspanins CD63, CD9, and CD151 to replicate in human synovial fibroblasts.
    Article Snippet: .. Oligonucleotides Silencer negative control no. 2 siRNA Thermo Fisher Scientific Cat# AM4613 Silencer GFP siRNA Thermo Fisher Scientific Cat# AM4626 CATCTGCACCCAAGTGTACCA microsynth qPCR CHIKV fw GCGCATTTTGCCTTCGTAATG microsynth qPCR CHIKV rev 6FAM-CggTgTACACTgCCTgTgACYgC—BBQ TIB MolBiol CHIKV probe Recombinant DNA pczVSV-G Hoffmann et al.43 https://doi.org/10.1099/vir.0.023978–0 pIRES2-eGFP CHIKV E3-E1 Salvador et al.44 https://doi.org/10.1016/j.virol.2009.07.013 pChik-LR-5‘GFP Tsetsarkin et al.40 https://doi.org/10.1089/vbz.2006.6.325 pChikRepl-eGFP Gläsker et al.45 https://doi.org/10.1186/1743-422X-10–23 pcDNA3.1(+) Addgene Cat# V790-20 Software and algorithms Fiji – ImageJ https://github.com/fiji/fiji Version 2.14.0/1.54f Graph Pad Prism Dotmatics Version 10 Incucyte Sartorius Version 2020 FlowJo FlowJo LLC Version 10.10.1 Huygens Compute Engine Scientific Volume Imaging Version 26.04 Adobe Illustrator Adobe Version 29.8.7 Affinity Studio Affinity Version 3.2.1 BioRender BioRender (https://biorender.com) RRID:SCR_018361 Other Chamber slides 8 well Ibidi Cat# 80841 Cell Reports 45, 118058, October 27, 2026 13 .. For each target, 3 siRNAs were purchased from Thermo Fisher Scientific and pooled for reverse transfection (Table S1).

    Real-time Polymerase Chain Reaction:

    Article Title: Chikungunya virus uses the tetraspanins CD63, CD9, and CD151 to replicate in human synovial fibroblasts.
    Article Snippet: .. Oligonucleotides Silencer negative control no. 2 siRNA Thermo Fisher Scientific Cat# AM4613 Silencer GFP siRNA Thermo Fisher Scientific Cat# AM4626 CATCTGCACCCAAGTGTACCA microsynth qPCR CHIKV fw GCGCATTTTGCCTTCGTAATG microsynth qPCR CHIKV rev 6FAM-CggTgTACACTgCCTgTgACYgC—BBQ TIB MolBiol CHIKV probe Recombinant DNA pczVSV-G Hoffmann et al.43 https://doi.org/10.1099/vir.0.023978–0 pIRES2-eGFP CHIKV E3-E1 Salvador et al.44 https://doi.org/10.1016/j.virol.2009.07.013 pChik-LR-5‘GFP Tsetsarkin et al.40 https://doi.org/10.1089/vbz.2006.6.325 pChikRepl-eGFP Gläsker et al.45 https://doi.org/10.1186/1743-422X-10–23 pcDNA3.1(+) Addgene Cat# V790-20 Software and algorithms Fiji – ImageJ https://github.com/fiji/fiji Version 2.14.0/1.54f Graph Pad Prism Dotmatics Version 10 Incucyte Sartorius Version 2020 FlowJo FlowJo LLC Version 10.10.1 Huygens Compute Engine Scientific Volume Imaging Version 26.04 Adobe Illustrator Adobe Version 29.8.7 Affinity Studio Affinity Version 3.2.1 BioRender BioRender (https://biorender.com) RRID:SCR_018361 Other Chamber slides 8 well Ibidi Cat# 80841 Cell Reports 45, 118058, October 27, 2026 13 .. For each target, 3 siRNAs were purchased from Thermo Fisher Scientific and pooled for reverse transfection (Table S1).

    Recombinant:

    Article Title: Chikungunya virus uses the tetraspanins CD63, CD9, and CD151 to replicate in human synovial fibroblasts.
    Article Snippet: .. Oligonucleotides Silencer negative control no. 2 siRNA Thermo Fisher Scientific Cat# AM4613 Silencer GFP siRNA Thermo Fisher Scientific Cat# AM4626 CATCTGCACCCAAGTGTACCA microsynth qPCR CHIKV fw GCGCATTTTGCCTTCGTAATG microsynth qPCR CHIKV rev 6FAM-CggTgTACACTgCCTgTgACYgC—BBQ TIB MolBiol CHIKV probe Recombinant DNA pczVSV-G Hoffmann et al.43 https://doi.org/10.1099/vir.0.023978–0 pIRES2-eGFP CHIKV E3-E1 Salvador et al.44 https://doi.org/10.1016/j.virol.2009.07.013 pChik-LR-5‘GFP Tsetsarkin et al.40 https://doi.org/10.1089/vbz.2006.6.325 pChikRepl-eGFP Gläsker et al.45 https://doi.org/10.1186/1743-422X-10–23 pcDNA3.1(+) Addgene Cat# V790-20 Software and algorithms Fiji – ImageJ https://github.com/fiji/fiji Version 2.14.0/1.54f Graph Pad Prism Dotmatics Version 10 Incucyte Sartorius Version 2020 FlowJo FlowJo LLC Version 10.10.1 Huygens Compute Engine Scientific Volume Imaging Version 26.04 Adobe Illustrator Adobe Version 29.8.7 Affinity Studio Affinity Version 3.2.1 BioRender BioRender (https://biorender.com) RRID:SCR_018361 Other Chamber slides 8 well Ibidi Cat# 80841 Cell Reports 45, 118058, October 27, 2026 13 .. For each target, 3 siRNAs were purchased from Thermo Fisher Scientific and pooled for reverse transfection (Table S1).



    Similar Products

    algorithms incucyte s3 software sartorius prism 10 graphpad software flowjo bd compass  (Sartorius AG)
    99
    Sartorius AG algorithms incucyte s3 software sartorius prism 10 graphpad software flowjo bd compass
    Algorithms Incucyte S3 Software Sartorius Prism 10 Graphpad Software Flowjo Bd Compass, supplied by Sartorius AG, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/flowjo+analysis+software/Live+Cell+Analysis+Instruments/pmc12490239__mmc8-200-17-21
    Average 99 stars, based on 1 article reviews
    algorithms incucyte s3 software sartorius prism 10 graphpad software flowjo bd compass - by Bioz Stars, 2026-11
    99/100 stars
    		  Buy from Supplier
    n a incucyte software sartorius n a flowjo tm bd life sciences n a r2 genomics r2 genomics  (Sartorius AG)
    99
    Sartorius AG n a incucyte software sartorius n a flowjo tm bd life sciences n a r2 genomics r2 genomics
    N A Incucyte Software Sartorius N A Flowjo Tm Bd Life Sciences N A R2 Genomics R2 Genomics, supplied by Sartorius AG, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/flowjo+analysis+software/Live+Cell+Analysis+Instruments/pm40664206-309-82-85
    Average 99 stars, based on 1 article reviews
    n a incucyte software sartorius n a flowjo tm bd life sciences n a r2 genomics r2 genomics - by Bioz Stars, 2026-11
    99/100 stars
    		  Buy from Supplier
    flowjo version 10 software analysis  (Tree Star Inc)
    90
    Tree Star Inc flowjo version 10 software analysis
    Flowjo Version 10 Software Analysis, supplied by Tree Star Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/flowjo+analysis+software/flow+jo+software/pm39837817-136-4-9
    Average 90 stars, based on 1 article reviews
    flowjo version 10 software analysis - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    flowjo software analysis program  (Tree Star Inc)
    90
    Tree Star Inc flowjo software analysis program
    Flowjo Software Analysis Program, supplied by Tree Star Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/flowjo+analysis+software/flow+jo+software/bio_rxiv__2025__01__15__633135-65-14-18
    Average 90 stars, based on 1 article reviews
    flowjo software analysis program - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    flowjo cytometry analysis software v10.7 or v10.9  (Tree Star Inc)
    90
    Tree Star Inc flowjo cytometry analysis software v10.7 or v10.9
    Flowjo Cytometry Analysis Software V10.7 Or V10.9, supplied by Tree Star Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/flowjo+analysis+software/flow+jo+software/pm39222660-324-12-13
    Average 90 stars, based on 1 article reviews
    flowjo cytometry analysis software v10.7 or v10.9 - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    flowjo ™ analysis software v10.6  (Tree Star Inc)
    90
    Tree Star Inc flowjo ™ analysis software v10.6
    Flowjo ™ Analysis Software V10.6, supplied by Tree Star Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/flowjo+analysis+software/flow+jo+software/bio_rxiv__2024__11__06__622391-146-10-15
    Average 90 stars, based on 1 article reviews
    flowjo ™ analysis software v10.6 - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    flowjo cytometry analysis software  (Tree Star Inc)
    90
    Tree Star Inc flowjo cytometry analysis software
    Flowjo Cytometry Analysis Software, supplied by Tree Star Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/flowjo+analysis+software/flow+jo+software/pmc11570272-82-17-21
    Average 90 stars, based on 1 article reviews
    flowjo cytometry analysis software - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    flowjo analysis software  (Tree Star Inc)
    90
    Tree Star Inc flowjo analysis software
    Flowjo Analysis Software, supplied by Tree Star Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/flowjo+analysis+software/flow+jo+software/pmc11633534-152-7-10
    Average 90 stars, based on 1 article reviews
    flowjo analysis software - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier

    Image Search Results